Stem-loop sequence ola-mir-20a-2

AccessionMI0019539 (change log)
DescriptionOryzias latipes miR-20a-2 stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention ola-mir-20a-2
(4 sentences)

Stem-loop
   aaucc  uc     uc  u      -a           g     g   --u  u 
5'      ac  agguu  ag aguauu  aagugcuuaua ugcag uag   uc g
        ||  |||||  || ||||||  ||||||||||| ||||| |||   ||  
3'      ug  uccga  uc ucauga  uucacgagugu acguc auc   ag u
   --uuc  cu     --  u      ag           g     -   uuu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
21: 25693363-25693464 [-]
sense
ENSORLT00000026117 ; ola-mir-20a-2-201; exon 1
Clustered miRNAs
< 10kb from ola-mir-20a-2
ola-mir-1721: 25694055-25694151 [-]
ola-mir-18-221: 25693655-25693746 [-]
ola-mir-19a21: 25693520-25693627 [-]
ola-mir-20a-221: 25693363-25693464 [-]
ola-mir-19b-121: 25693239-25693340 [-]
ola-mir-92a-121: 25693131-25693234 [-]
Database links

Mature sequence ola-miR-20a

Accession MIMAT0022533
Sequence

25 - 

uaaagugcuuauagugcaggu

 - 45

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).