Stem-loop sequence ola-mir-10b

AccessionMI0019535 (change log)
DescriptionOryzias latipes miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention ola-mir-10b
(9 sentences)

Stem-loop
   ucguggcuucc     u        a    g     c          --   ag 
5'            cgucg cuauauau cccu uagaa cgaauuugug  uga  a
              ||||| |||||||| |||| ||||| ||||||||||  |||  a
3'            guagc gguauaug gggg aucuu gcuuagacac  acu  c
   acuucaaaaaa     u        a    -     a          ua   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
21: 24625727-24625834 [+]
sense
ENSORLT00000021952 ; HOXD3A-201; intron 1
Database links

Mature sequence ola-miR-10b

Accession MIMAT0022651
Sequence

25 - 

uacccuguagaaccgaauuugu

 - 46

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).