Stem-loop sequence ola-mir-15a

AccessionMI0019534 (change log)
DescriptionOryzias latipes miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention ola-mir-15a
(4 sentences)

Stem-loop
   gcugaccggagcucugguga     ua         a          gg  a 
5'                     ugcug  gcagcacgg augguuugug  uu u
                       |||||  ||||||||| ||||||||||  || u
3'                     augac  cgucgugcc uaccggacgu  ag g
   ---caacacauuagcccgua     gc         g          ag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
21: 11191711-11191814 [+]
intergenic
Database links

Mature sequence ola-miR-15a

Accession MIMAT0022650
Sequence

26 - 

uagcagcacggaaugguuug

 - 45

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).