Stem-loop sequence ola-mir-124-3

AccessionMI0019533 (change log)
DescriptionOryzias latipes miR-124-3 stem-loop
Gene family MIPF0000021; mir-124
Literature search

3 open access papers mention ola-mir-124-3
(6 sentences)

Stem-loop
   --agc     gu      cc        a   ga        -   u 
5'      ggguu  gucucu  guguucac gcg  ccuugauu uaa g
        |||||  ||||||  |||||||| |||  |||||||| |||  
3'      ccuag  uagaga  cguaagug cgc  ggaauuaa auu u
   uaccu     --      ac        g   ac        c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
20: 15452264-15452354 [-]
intergenic
Database links

Mature sequence ola-miR-124-5p

Accession MIMAT0022689
Sequence

18 - 

cguguucacagcggaccuu

 - 36

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-124-3p

Accession MIMAT0022573
Sequence

55 - 

uaaggcacgcggugaaugcca

 - 75

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).