Stem-loop sequence ola-mir-24b

Accession MI0019526
Description Oryzias latipes miR-24b stem-loop
Gene family MIPF0000041; mir-24
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-24_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-24 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR-24 is conserved in various species, and is clustered with miR-23 and miR-27, on human chromosome 9 and 19. Recently, miR-24 has been shown to suppress expression of two crucial cell cycle control genes, E2F2 and Myc in hematopoietic differentiation and also to promote keratinocyte differentiation by repressing actin-cytoskeleton regulators PAK4, Tsk5 and ArhGAP19.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-g  g   cuu    uc   c   a  g   a         uaa    uuuac  ga 
  cu cug   gggc  aac ucc gu ccu cugagcuga   cagu     cu  a
  || |||   ||||  ||| ||| || ||| |||||||||   ||||     ||   
  ga gau   cccg  uug agg ca gga gacuugacu   guca     ga  a
ca  -   -cu    ga   -   c  a   c         -cg    ----u  ac 
Get sequence
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
17: 29776748-29776854 [-]
sense
Clustered miRNAs
< 10kb from ola-mir-24b
ola-mir-23a-2 17: 29781101-29781198 [-]
ola-mir-27a 17: 29779201-29779293 [-]
ola-mir-24b 17: 29776748-29776854 [-]

Mature sequence ola-miR-24b-5p

Accession MIMAT0022644
Sequence

26 - 

ugccuacugagcugauaacagu

 - 47

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-24b-3p

Accession MIMAT0022645
Sequence

66 - 

uggcucaguucagcagga

 - 83

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).