Stem-loop sequence ola-mir-1-2

AccessionMI0019525 (change log)
DescriptionOryzias latipes miR-1-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

4 open access papers mention ola-mir-1-2
(15 sentences)

Stem-loop
   --acaau      -  u                     a  --------     g 
5'        uacuuc cc gggguacauacuucuuuaugu cc        cauau a
          |||||| || ||||||||||||||||||||| ||        |||||  
3'        guggag gg ucuuauguaugaagaaaugua gg        guaua a
   ucugagc      u  c                     a  uaucgaaa     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
17: 29410125-29410225 [-]
antisense
ENSORLT00000022108 ; mib-201; intron 12
Clustered miRNAs
< 10kb from ola-mir-1-2
ola-mir-1-217: 29410125-29410225 [-]
ola-mir-133-117: 29407313-29407419 [-]
Database links

Mature sequence ola-miR-1-3p

Accession MIMAT0022558
Sequence

60 - 

uggaauguaaagaaguaugua

 - 80

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).