Stem-loop sequence ola-mir-199a-4

AccessionMI0019518 (change log)
DescriptionOryzias latipes miR-199a-4 stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention ola-mir-199a-4
(2 sentences)

Stem-loop
   au        c   cac       u        c   u    guc 
5'   uccggcuc guc   ccagugu cagacuac ugu cauu   a
     |||||||| |||   ||||||| |||||||| ||| ||||    
3'   gggccggg cag   gguuaca gucugaug aca gugg   u
   uc        u   auu       c        -   u    uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
17: 16117948-16118038 [+]
antisense
ENSORLT00000012523 ; dnm3-201; intron 16
Clustered miRNAs
< 10kb from ola-mir-199a-4
ola-mir-199a-417: 16117948-16118038 [+]
ola-mir-21417: 16119235-16119335 [+]
Database links

Mature sequence ola-miR-199a-5p

Accession MIMAT0022538
Sequence

17 - 

cccaguguucagacuaccuguu

 - 38

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-199a-3p

Accession MIMAT0022539
Sequence

56 - 

acaguagucugcacauugguua

 - 77

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).