Stem-loop sequence ola-mir-9a-1

AccessionMI0019515 (change log)
DescriptionOryzias latipes miR-9a-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

4 open access papers mention ola-mir-9a-1
(14 sentences)

Stem-loop
   gggaagccuuc      ga      uc               g      u   g 
5'            gggguu  uuguua  uuugguuaucuagcu uaugag gau u
              ||||||  ||||||  ||||||||||||||| |||||| |||  
3'            cccuaa  aacaau  aagccaauagaucga auacuu uua a
   -ccucacauua      -g      ga               a      c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
16: 23834590-23834697 [+]
intergenic
Database links

Mature sequence ola-miR-9a-5p

Accession MIMAT0022636
Sequence

26 - 

ucuuugguuaucuagcuguauga

 - 48

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-9a-3p

Accession MIMAT0022537
Sequence

65 - 

auaaagcuagauaaccgaaag

 - 85

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).