Stem-loop sequence ola-mir-146a

AccessionMI0019514 (change log)
DescriptionOryzias latipes miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
       -     -a      cua   u         au          gu g  u 
5' guuu acgag  agugcu   cua gagaacuga  uccauagaug  a cu u
   |||| |||||  ||||||   ||| |||||||||  ||||||||||  | || u
3' cgag uguuu  ucaugg   ggu uucuugacu  ggguaucuac  u ga c
       c     gg      uac   u         -c          ug g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
15: 22802269-22802374 [-]
intergenic
Database links

Mature sequence ola-miR-146a-5p

Accession MIMAT0022635
Sequence

23 - 

ugagaacugaauuccauagauggua

 - 47

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).