Stem-loop sequence ola-mir-10d

AccessionMI0019513 (change log)
DescriptionOryzias latipes miR-10d stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention ola-mir-10d
(9 sentences)

Stem-loop
   gac  -gaaccu         c  a    g       g   g    -ug   c 
5'    gg       ucgcccaua au cccu uagaacc aau ugug   gag u
      ||       ||||||||| || |||| ||||||| ||| ||||   |||  
3'    cc       agcggguau ug gggg aucuugg uua acac   cuc g
   cua  aaucagu         c  a    -       g   g    uga   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
15: 4353705-4353809 [-]
sense
ENSORLT00000026111 ; ola-mir-10d-201; exon 1
Database links

Mature sequence ola-miR-10d

Accession MIMAT0022633
Sequence

23 - 

uacccuguagaaccgaaugugu

 - 44

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).