Stem-loop sequence ola-mir-144

AccessionMI0019501 (change log)
DescriptionOryzias latipes miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   ca   cuccaucu    -       c  g         u        -a    aa 
5'   cgg        ugag cccugga ag auaucaucu auacugua  guuu  u
     |||        |||| ||||||| || ||||||||| ||||||||  ||||  a
3'   guc        acuu gggaccu uc uguaguaga uaugacau  caga  a
   --   uccaccuu    u       a  a         -        ca    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
14: 21443523-21443630 [+]
intergenic
Database links

Mature sequence ola-miR-144

Accession MIMAT0022626
Sequence

26 - 

aggauaucaucuuauacuguaa

 - 47

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).