Stem-loop sequence ola-mir-194

AccessionMI0019499 (change log)
DescriptionOryzias latipes miR-194 stem-loop
Gene family MIPF0000055; mir-194
Literature search

1 open access papers mention ola-mir-194
(1 sentences)

Stem-loop
   u    cau  cc   c    g     u  aug        a      g     g ug 
5'  cggc   gg  uug uggu uuugc gg   uaacagca cuccau uggaa c  u
    ||||   ||  ||| |||| ||||| ||   |||||||| |||||| ||||| |  g
3'  gucg   cc  agc acca agacg cc   auugucgu gaggug accuu g  u
   g    --c  ca   c    g     u  ---        g      -     - uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
14: 20215672-20215781 [+]
intergenic
Clustered miRNAs
< 10kb from ola-mir-194
ola-mir-19414: 20215672-20215781 [+]
ola-mir-19214: 20215822-20215919 [+]
Database links

Mature sequence ola-miR-194-5p

Accession MIMAT0022622
Sequence

31 - 

uguaacagcaacuccaugu

 - 49

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-194-3p

Accession MIMAT0022623
Sequence

66 - 

ccaguggaggugcuguuaccug

 - 87

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).