Stem-loop sequence ola-mir-22-1

AccessionMI0019496 (change log)
DescriptionOryzias latipes miR-22-1 stem-loop
Gene family MIPF0000053; mir-22
Stem-loop
   acu        c              -      a      -----   uc 
5'    ggcugacc acagcaguucuuca cuggca gcuuua     ugu  u
      |||||||| |||||||||||||| |||||| ||||||     |||   
3'    ucggcugg uguugucaagaagu gaccgu cgaaau     acg  c
   uuc        -              c      -      cgacc   ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
13: 16589470-16589563 [-]
intergenic
Database links

Mature sequence ola-miR-22

Accession MIMAT0022618
Sequence

59 - 

aagcugccagcugaagaacug

 - 79

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).