Stem-loop sequence ola-mir-139

AccessionMI0019494 (change log)
DescriptionOryzias latipes miR-139 stem-loop
Gene family MIPF0000117; mir-139
Stem-loop
   uauuau  -     c   -      -   u  a  u          u  ua 
5'       gg ccugg ugu auucua cag gc ug gucuccagua gu  g
         || ||||| ||| |||||| ||| || || |||||||||| ||  u
3'       cc ggacc aca uaaggu guc cg gc cagaggucau cg  g
   -gcaac  a     a   a      u   u  -  u          -  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
13: 21690229-21690327 [+]
intergenic
Database links

Mature sequence ola-miR-139

Accession MIMAT0022616
Sequence

20 - 

ucuacagugcaugugucucca

 - 40

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).