Stem-loop sequence ola-mir-301b

AccessionMI0019489 (change log)
DescriptionOryzias latipes miR-301b stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   cugacacau           c    c       ---        a   uacca 
5'          gcugaggucag ugcu ugacaau   guugcacu cug     u
            ||||||||||| |||| |||||||   |||||||| |||      
3'          cgacuccgguu acga acuguua   uaacguga gau     c
   gaucucgcu           u    u       uga        c   cuuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
12: 14199739-14199843 [-]
intergenic
Clustered miRNAs
< 10kb from ola-mir-301b
ola-mir-130c12: 14200032-14200135 [-]
ola-mir-301b12: 14199739-14199843 [-]
Database links

Mature sequence ola-miR-301b-5p

Accession MIMAT0022610
Sequence

23 - 

gcucugacaauguugcacuac

 - 43

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-301b-3p

Accession MIMAT0022611
Sequence

61 - 

cagugcaauaguauuguc

 - 78

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).