Stem-loop sequence ola-mir-101b

AccessionMI0019486 (change log)
DescriptionOryzias latipes miR-101b stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention ola-mir-101b
(2 sentences)

Stem-loop
   gg      gacu   -a      c                    cg     g  ug 
5'   gcagug    aug  acuguc auuuucaguuaucaugguac  gugcu ug  c
     ||||||    |||  |||||| ||||||||||||||||||||  ||||| ||  c
3'   ugucgc    uac  ugacgg uagaagucaauaguaucaug  cauga ac  u
   ca      ----   cg      u                    -a     -  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
12: 15502016-15502123 [+]
sense
ENSORLT00000013086 ; rcl1-201; intron 8
Database links

Mature sequence ola-miR-101b-5p

Accession MIMAT0022605
Sequence

28 - 

ucaguuaucaugguaccggugcu

 - 50

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-101b-3p

Accession MIMAT0022606
Sequence

64 - 

guacaguacuaugauaacu

 - 82

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).