Stem-loop sequence ola-mir-199a-3

AccessionMI0019485 (change log)
DescriptionOryzias latipes miR-199a-3 stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention ola-mir-199a-3
(2 sentences)

Stem-loop
   uacccc    cccau  c     c       u        c   u   gaag 
5'       uccc     cc gccug ccagugu cagacuac ugu cag    u
         ||||     || ||||| ||||||| |||||||| ||| |||     
3'       aggg     gg cggau gguuaca gucugaug aca guu    a
   gcguga    --auu  u     u       c        -   u   ggug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
12: 11677445-11677547 [+]
antisense
ENSORLT00000008818 ; dnm1a-201; intron 15
Database links

Mature sequence ola-miR-199a-5p

Accession MIMAT0022538
Sequence

24 - 

cccaguguucagacuaccuguu

 - 45

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-199a-3p

Accession MIMAT0022539
Sequence

63 - 

acaguagucugcacauugguua

 - 84

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).