|
miRBase |
|
Stem-loop sequence ola-mir-126 |
|||||||||||||||||||||||||||||||||||||||
| Accession | MI0019483 | ||||||||||||||||||||||||||||||||||||||
| Description | Oryzias latipes miR-126 stem-loop | ||||||||||||||||||||||||||||||||||||||
| Gene family | MIPF0000115; mir-126 | ||||||||||||||||||||||||||||||||||||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled Mir-126. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours. Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages: You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages. Please note, we're not responsible for the content of Wikipedia pages. You can read more about miRBase, Wikipedia and community annotation on this blog post. Please email us for help or with comments about this community annotation initiative. In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels, and acts upon various transcripts to control angiogenesis.
In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels,[1] and acts upon various transcripts to control angiogenesis.[2]
Genomic Location [edit]miR-126 is located within the 7th intron of the EGFL7 gene which resides on human chromosome 9.[3] mir-126* [edit]mir-126* is the complementary strand to mir-126 which forms once the double stranded pri-miRNA is cleaved and the two strands denature, separating. mir-126* is less abundantly found in organisms than mir-126 and fewer roles in regulating gene expression have been identified. However, mir-126* has recently been implicated in the silencing of prostien in non-endothelial cells. Prostein is able to be produced specifically in the prostate through the silencing of both mir-126* and EGFL7.[4] Regulation of expression [edit]mir-126 is regulated by the binding of two transcription factors: ETS1 and ETS2.[5] Binding of these factors induce the transcription of the mir-126 pre-miRNA resulting in the formation of the hairpin pri-miRNA. Hairpin miRNA is targeted to Dicer for cleavage, producing mature mir-126 and mir-126* transcripts. Epigenetic regulation of the host gene by accumulation of methylation and gene silencing nucleosomes reduces expression of intronic miRNA affecting. This has been observed in cancers which benefit from the silencing of both EGFL7 and mir-126, resulting in neither being expressed.[6] Only one Single-nucleotide polymorphism within mir-126 has been identified. A change to the 24th base prevents the processing of the pri-miRNA into the mature miRNA, reducing the suppression of the various targets of mir-126.[7] The frequency of the SNP varies between different ethnic backgrounds and potentially is related to the differential acquisition of human disease. Targets of mir-126 [edit]miRNA binds to target sequences reducing the expression of the target gene. miRNA can bind either directly to DNA preventing transcription or to transcribed mRNA preventing translation and directing the mRNA for degradation. One of the main targets of mir-126 is the host gene EGFL7. Transcription of both occur, however mature mir-126 binds to a complementary sequence within EGFL7 preventing translation of the mRNA resulting in a decrease of EGFL7 protein levels.[8] EGFL7 is known to be involved in cell migration and blood vessel formation,[9] making EGFL7 and mir-126 opportune targets for disease, such as cancers, which require the continual formation of blood vessels to supply the tumour with nutrients and cell migration pathways to mediate tissue invasion.
Involvement in homeostasis [edit]Tissue repair and maintenance are important parts of the life cycle of an organism, cells and tissues must remain in homeostasis to ensure survival. This includes controlled cell death and responses to wounds. During apoptosis cell death, cells release apoptotic bodies containing paracrine signals to neighbouring cells. In endothelial cells, mir-126 is also released with in these bodies are upon absorption in a neighbouring cell induce the CXCL12 dependant vascular protection.[13] CXCL12 binds the receptor CXCR4 actively counteracting apoptosis and recruiting progenitor cells to the site of injury. Involvement in disease [edit]Cancer [edit]mir-126 has been shown to be both a tumour suppressor and an oncogene depending on the type of cancer. Inhibition of cancer progression occurs through mir-126s negative control of proliferation, migration, invasion and cell survival, while mir-126 also may support cancer progression through the promotion of blood vessel formation and inflammation at the site of activation.[3]
Diabetes [edit]Low expression levels of many types of miRNA have been observed in type 2 diabetes including: mir-15a, mir-20b, mir-21, mir-124, mir-126, mir-191, mir-197, mir-223, mir-320 and mir-486.[22] Increased expression of mir-28-3p has also been observed.[22] The consequence of misregulation of these miRNAs has not been fully elucidated, however mir-126 has been shown to decrease in expression in response to high glucose levels.[22] Interestingly the decrease of mir-15a, mir-29b, mir-126 and mir-223 proceedes the manifestation of the disease, making these transcripts a possible target for diagnostic testing for type 2 diabetes. Cystic fibrosis [edit]Comparisons of cystic fibrosis against non-cystic fibrosis airway epithelial cells shows that various miRNAs are differentially regulated in response to the disease. mir-126 is suspected to play a role in regulating the innate immune responses within Cystic Fibrosis affected lungs.[12] Allergic asthma [edit]mir-126 increases the immune response to certain antigens resulting in overstimulation of the immune system and allergic asthma. T Helper 2 Cells are affected by mir-126 through a complicated interaction pathway, an increase in mir-126 results in an increase of the response of T Helper 2 Cells.[14] See also [edit]References [edit]
Further reading [edit]
External links [edit]
|
||||||||||||||||||||||||||||||||||||||
| Stem-loop |
-cgcaacaug cu c u c cuaugc gccag uugcggu cauuauuacuu ugguacg g c ||||| ||||||| ||||||||||| ||||||| | a ugguc agcguca guaauaaugag gccaugc c c gccucagccg -- c u u aacucuGet sequence |
||||||||||||||||||||||||||||||||||||||
| Genome context |
|
||||||||||||||||||||||||||||||||||||||
Mature sequence ola-miR-126-5p |
|
| Accession | MIMAT0022602 |
| Sequence |
25 - cauuauuacuuuugguacgcg - 45 |
| Evidence | experimental; SOLiD [1] |
Mature sequence ola-miR-126-3p |
|
| Accession | MIMAT0022603 |
| Sequence |
62 - ucguaccgugaguaauaaug - 81 |
| Evidence | experimental; SOLiD [1] |
References |
|
| 1 |
PMID:21143817
"Discovery and characterization of medaka miRNA genes by next generation sequencing platform"
Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC
BMC Genomics. 11 Suppl 4:S8(2010).
|
Comments, questions? Email mirbase@manchester.ac.uk