Stem-loop sequence ola-mir-1306

AccessionMI0019471 (change log)
DescriptionOryzias latipes miR-1306 stem-loop
Gene family MIPF0000531; mir-1306
Stem-loop
   cucccauuggagccuccugaugauuucggccuggaacagggcagggcaccuccaccaccuccccugca        gug  gc 
5'                                                                     aacgucca   ac  a
                                                                       ||||||||   ||   
3'                                                                     uugcaggu   ug  g
   ---------------------------------------------------------gguggucucga        -aa  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
9: 23130448-23130557 [-]
sense
ENSORLT00000018998 ; ola-mir-1306-201; exon 1
Database links

Mature sequence ola-miR-1306

Accession MIMAT0022590
Sequence

55 - 

ccaccuccccugcaaacgucc

 - 75

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).