Stem-loop sequence ola-mir-181b-2

AccessionMI0019466 (change log)
DescriptionOryzias latipes miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention ola-mir-181b-2
(18 sentences)

Stem-loop
   --uc     gucaaccuuaa       auaaa         cu           uaug 
5'     cagga           ggcugca     cauucauug  gucgguggguu    c
       |||||           |||||||     |||||||||  |||||||||||    a
3'     guccu           uuggcgu     guaaguaac  uagucacucaa    g
   aguc     -----acacgc       caaac         --           caag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
9: 27956674-27956783 [+]
intergenic
Clustered miRNAs
< 10kb from ola-mir-181b-2
ola-mir-181a-19: 27956541-27956646 [+]
ola-mir-181b-29: 27956674-27956783 [+]
Database links

Mature sequence ola-miR-181b-5p

Accession MIMAT0022540
Sequence

29 - 

aacauucauugcugucgguggguu

 - 52

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).