Stem-loop sequence ola-mir-24c

AccessionMI0019464 (change log)
DescriptionOryzias latipes miR-24c stem-loop
Stem-loop
   uaaaauccauagugauauucauuacu    u   ---ag   aga   g     -  ga 
5'                           uuaa gca     cug   gaa ugagc au  u
                             |||| |||     |||   ||| ||||| ||   
3'                           aauu ugu     gac   cuu acucg ua  u
   -------------------auuuucc    c   aacaa   -ga   g     g  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
9: 7539271-7539366 [+]
intergenic
Database links

Mature sequence ola-miR-24c

Accession MIMAT0022585
Sequence

61 - 

uggcucaguucagcagaa

 - 78

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).