Stem-loop sequence ola-mir-150

AccessionMI0019463 (change log)
DescriptionOryzias latipes miR-150 stem-loop
Literature search

1 open access papers mention ola-mir-150
(1 sentences)

Stem-loop
   guguucucaggagccggacgcauuucugcagaucuuccuccaaaggucucgguccggucacucccaauc     a        -  g 
5'                                                                      cuugu ccaguguc cu c
                                                                        ||||| |||||||| || u
3'                                                                      ggaca ggucgcgg gg a
   ------------------------------------------------------------------uuu     -        u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
8: 25382196-25382304 [-]
sense
Database links

Mature sequence ola-miR-150

Accession MIMAT0022584
Sequence

60 - 

acucccaauccuuguaccagu

 - 80

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).