Stem-loop sequence ola-mir-338-1

AccessionMI0019459 (change log)
DescriptionOryzias latipes miR-338-1 stem-loop
Gene family MIPF0000097; mir-338
Stem-loop
   acu   -  g      a     c   -         ccu    g  u 
5'    ggc ug ucccag aacaa auc cuggugcug   gagu ug a
      ||| || |||||| ||||| ||| |||||||||   |||| || a
3'    ccg gc gggguc uuguu uag gacuacgac   cuca ac u
   ucc   u  g      g     u   u         ---    a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
8: 10136028-10136119 [-]
sense
ENSORLT00000009387 ; aatka-201; intron 7
Database links

Mature sequence ola-miR-338-5p

Accession MIMAT0022579
Sequence

17 - 

aacaacauccuggugcugccugagu

 - 41

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-338-3p

Accession MIMAT0022580
Sequence

55 - 

uccagcaucagugauuuuguu

 - 75

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).