Stem-loop sequence ola-mir-199a-2

AccessionMI0019455 (change log)
DescriptionOryzias latipes miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention ola-mir-199a-2
(2 sentences)

Stem-loop
   ucucuaucc    -cccc     c       u        c     cuccag 
5'          ccca     gccug ccagugu cagacuac uguuc      c
            ||||     ||||| ||||||| |||||||| |||||       
3'          gggu     cggau gguuaca gucugaug acaag      u
   acacaccga    cagau     u       c        -     ucaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
8: 9465167-9465270 [+]
sense
ENSORLT00000026048 ; ola-mir-199a-2-201; exon 1
antisense
ENSORLT00000008601 ; dnm2a-201; intron 15
Database links

Mature sequence ola-miR-199a-5p

Accession MIMAT0022538
Sequence

23 - 

cccaguguucagacuaccuguu

 - 44

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-199a-3p

Accession MIMAT0022539
Sequence

62 - 

acaguagucugcacauugguua

 - 83

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).