Stem-loop sequence ola-mir-124-2

AccessionMI0019452 (change log)
DescriptionOryzias latipes miR-124-2 stem-loop
Gene family MIPF0000021; mir-124
Literature search

3 open access papers mention ola-mir-124-2
(6 sentences)

Stem-loop
   -gaca a   g -u    a   cuc        a   ga         auua 
5'      g cug a  uucc cuc   guguucac gcg  cuuuaauug    a
        | ||| |  |||| |||   |||||||| |||  |||||||||     
3'      c gac u  aagg gag   cguaagug cgc  ggaauuaac    g
   uuacg c   g cu    a   aac        g   ac         acgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
7: 22012171-22012274 [-]
intergenic
Database links

Mature sequence ola-miR-124-3p

Accession MIMAT0022573
Sequence

61 - 

uaaggcacgcggugaaugcca

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).