Stem-loop sequence ola-mir-29a

AccessionMI0019447 (change log)
DescriptionOryzias latipes miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

3 open access papers mention ola-mir-29a
(19 sentences)

Stem-loop
   ----     cuuuc  ag  u          uuu       -----     u 
5'     guccu     ca  gu gaccgauuuc   ugguguu     cagag c
       |||||     ||  || ||||||||||   |||||||     |||||  
3'     cagga     gu  ca uuggcuaaag   accacga     gucuu c
   uaga     ----a  ga  -          uuu       ucuuu     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
7: 23588631-23588722 [+]
intergenic
Clustered miRNAs
< 10kb from ola-mir-29a
ola-mir-29b-17: 23588373-23588474 [+]
ola-mir-29a7: 23588631-23588722 [+]
Database links

Mature sequence ola-miR-29a

Accession MIMAT0022570
Sequence

57 - 

agcaccauuugaaaucgguuac

 - 78

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).