Stem-loop sequence ola-mir-196a

AccessionMI0019442 (change log)
DescriptionOryzias latipes miR-196a stem-loop
Gene family MIPF0000031; mir-196
Literature search

1 open access papers mention ola-mir-196a
(7 sentences)

Stem-loop
   -----uugc     g   ga        u          a          g u    
5'          gcgaa cug  gcgugguu agguaguuuc uguuguuggg u ggc 
            ||||| |||  |||||||| |||||||||| |||||||||| | || u
3'          ugcuu gac  ugcauuag uccgucaaag acaacggcuc g ccu 
   aacuacuuc     -   --        u          a          g u    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
7: 12869858-12869962 [+]
sense
ENSORLT00000009939 ; HOXC3A-201; intron 1
ENSORLT00000026075 ; ola-mir-196a-201; exon 1
Database links

Mature sequence ola-miR-196a

Accession MIMAT0022564
Sequence

24 - 

uagguaguuucauguuguugg

 - 44

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).