Stem-loop sequence ola-mir-183-1

AccessionMI0019436 (change log)
DescriptionOryzias latipes miR-183-1 stem-loop
Gene family MIPF0000066; mir-183
Literature search

1 open access papers mention ola-mir-183-1
(2 sentences)

Stem-loop
   auccacaa   -c  -         g      --ac     ga        ucacag 
5'         uuc  uc cuauucugu uauggc    uggua  auucacug      c
           |||  || ||||||||| ||||||    |||||  ||||||||       
3'         aag  ag gaugagaca auaccg    accau  uaagugac      a
   -ugacucc   ac  a         a      ggau     --        uaucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
6: 16407646-16407754 [-]
sense
ENSORLT00000026106 ; ola-mir-183-1-201; exon 1
Database links

Mature sequence ola-miR-183-5p

Accession MIMAT0022555
Sequence

26 - 

auggcacugguagaauuca

 - 44

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-183-3p

Accession MIMAT0022556
Sequence

64 - 

gugaauuaccauagggccaua

 - 84

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).