Stem-loop sequence ola-mir-184-2

AccessionMI0019432 (change log)
DescriptionOryzias latipes miR-184-2 stem-loop
Gene family MIPF0000059; mir-184
Literature search

1 open access papers mention ola-mir-184-2
(1 sentences)

Stem-loop
   aaugu     a      cu        c      a c     uaucu   a 
5'      uguca gcacau  ccuuauca uuuucc g ccagc     gac a
        ||||| ||||||  |||||||| |||||| | |||||     |||  
3'      acggu cgugua  ggaauagu aagagg c gguug     uug a
   -uuuc     c      ug        c      - a     ----u   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
6: 12810246-12810343 [+]
intergenic
Database links

Mature sequence ola-miR-184-5p

Accession MIMAT0022535
Sequence

19 - 

uccuuaucacuuuuccagccca

 - 40

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-184-3p

Accession MIMAT0022536
Sequence

61 - 

uggacggagaacugauaaggg

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).