Stem-loop sequence ola-mir-499

AccessionMI0019429 (change log)
DescriptionOryzias latipes miR-499 stem-loop
Gene family MIPF0000173; mir-499
Literature search

3 open access papers mention ola-mir-499
(126 sentences)

Stem-loop
   ggacagcu    cu   a    ua       c           ggg  a 
5'         gggg  gag cagu  agacuug agugauguuua   ca u
           ||||  ||| ||||  ||||||| |||||||||||   ||  
3'         ucuc  cuc gucg  ucugaau ucacuacaagu   gu g
   ---cuuuu    uu   a    ug       u           aca  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
5: 26842783-26842879 [-]
intergenic
Database links

Mature sequence ola-miR-499

Accession MIMAT0022548
Sequence

60 - 

aacaucacuuuaagucugugc

 - 80

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).