Stem-loop sequence ola-mir-9b-1

AccessionMI0019427 (change log)
DescriptionOryzias latipes miR-9b-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

4 open access papers mention ola-mir-9b-1
(13 sentences)

Stem-loop
   uuuaagaaac    -c           c       a       g     guugg 
5'           gugg  uuaguuuuuau uuugguu ucuagcu uauga     u
             ||||  ||||||||||| ||||||| ||||||| |||||      
3'           cgcc  agucaaagaug aagccaa agaucga auacu     g
   --acgaccgu    uu           u       g       a     auaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
4: 2428407-2428513 [-]
intergenic
Database links

Mature sequence ola-miR-9b-5p

Accession MIMAT0022546
Sequence

26 - 

ucuuugguuaucuagcuguauga

 - 48

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).