Stem-loop sequence ola-mir-101a

AccessionMI0019424 (change log)
DescriptionOryzias latipes miR-101a stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention ola-mir-101a
(2 sentences)

Stem-loop
   ugcuagauuugaca   u   c gg                   a    g  cc 
5'               ggc gcc u  uucaguuaucacagugcug ugcu uc  c
                 ||| ||| |  ||||||||||||||||||| |||| ||   
3'               ccg cgg a  aagucaauagugucaugac augg ag  a
   -auacacaguucaa   u   u gg                   -    a  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
4: 16768335-16768442 [+]
intergenic
Database links

Mature sequence ola-miR-101a-5p

Accession MIMAT0022542
Sequence

27 - 

ucaguuaucacagugcugaugc

 - 48

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-101a-3p

Accession MIMAT0022543
Sequence

63 - 

guacaguacugugauaacuga

 - 83

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).