Stem-loop sequence ola-mir-199a-1

AccessionMI0019422 (change log)
DescriptionOryzias latipes miR-199a-1 stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention ola-mir-199a-1
(2 sentences)

Stem-loop
   ag  a   -   u c   auc       u        c   ---    aa 
5'   gc ucc ugc c guc   ccagugu cagacuac ugu   ucag  u
     || ||| ||| | |||   ||||||| |||||||| |||   ||||  c
3'   ug agg acg g cag   gguuaca gucugaug aca   gguc  u
   ua  a   u   u u   auu       c        -   ugu    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
4: 4302500-4302597 [+]
antisense
Database links

Mature sequence ola-miR-199a-5p

Accession MIMAT0022538
Sequence

20 - 

cccaguguucagacuaccuguu

 - 41

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-199a-3p

Accession MIMAT0022539
Sequence

59 - 

acaguagucugcacauugguua

 - 80

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).