Stem-loop sequence ola-mir-9a-2

AccessionMI0019421 (change log)
DescriptionOryzias latipes miR-9a-2 stem-loop
Gene family MIPF0000014; mir-9
Literature search

4 open access papers mention ola-mir-9a-2
(14 sentences)

Stem-loop
   -------    u  agcc        uc               g     -gu     
5'        ucag gg    uguuccug  uuugguuaucuagcu uauga   guga 
          |||| ||    ||||||||  ||||||||||||||| |||||   ||| u
3'        aguc cc    guaaggau  aagccaauagaucga auacu   cauu 
   acuccac    u  ---a        ga               a     acc     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
3: 20705983-20706084 [-]
intergenic
Database links

Mature sequence ola-miR-9a-3p

Accession MIMAT0022537
Sequence

59 - 

auaaagcuagauaaccgaaag

 - 79

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).