Stem-loop sequence ola-mir-92a-2

AccessionMI0019419 (change log)
DescriptionOryzias latipes miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Literature search

2 open access papers mention ola-mir-92a-2
(3 sentences)

Stem-loop
   --uggaagaug      -   g       g     u   a        gu  u 
5'            uccugu ccu ugcaggu gggau agu gcaaugcu  uc c
              |||||| ||| ||||||| ||||| ||| ||||||||  || c
3'            ggggca gga auguccg cccug uca cguuaugg  ag a
   gucgaaguaga      a   a       g     u   -        --  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
3: 15108084-15108186 [+]
intergenic
Clustered miRNAs
< 10kb from ola-mir-92a-2
ola-mir-18-13: 15107452-15107557 [+]
ola-mir-20a-13: 15107783-15107891 [+]
ola-mir-92a-23: 15108084-15108186 [+]
Database links

Mature sequence ola-miR-92a

Accession MIMAT0022534
Sequence

59 - 

uauugcacuugucccggccug

 - 79

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).