Stem-loop sequence ola-mir-20a-1

AccessionMI0019418 (change log)
DescriptionOryzias latipes miR-20a-1 stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention ola-mir-20a-1
(4 sentences)

Stem-loop
   uc   u  -ucc     uc  c      -a           g    --------     u 
5'   cag ga    caguu  ag aguacu  aagugcuuaua ugca        gguag g
     ||| ||    |||||  || ||||||  ||||||||||| ||||        ||||| u
3'   guc uu    gucaa  uc ucauga  uucacgaaugu acgu        ccauc u
   --   u  uuau     --  u      ag           a    caucuauu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
3: 15107783-15107891 [+]
sense
Clustered miRNAs
< 10kb from ola-mir-20a-1
ola-mir-18-13: 15107452-15107557 [+]
ola-mir-20a-13: 15107783-15107891 [+]
ola-mir-92a-23: 15108084-15108186 [+]
Database links

Mature sequence ola-miR-20a

Accession MIMAT0022533
Sequence

27 - 

uaaagugcuuauagugcaggu

 - 47

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).