Stem-loop sequence ola-mir-18-1

AccessionMI0019417 (change log)
DescriptionOryzias latipes miR-18-1 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   cauacgaug   u    -        --   u   uc   u    a   -  aaau 
5'          uac gucu uugugcua  agg gca  uag gcag uag ug    a
            ||| |||| ||||||||  ||| |||  ||| |||| ||| ||    g
3'          aug cggg aauacggu  ucc cgu  auc cguc auc ac    a
   ----guaua   u    g        cu   u   ga   c    -   c  gauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
3: 15107452-15107557 [+]
intergenic
Clustered miRNAs
< 10kb from ola-mir-18-1
ola-mir-18-13: 15107452-15107557 [+]
ola-mir-20a-13: 15107783-15107891 [+]
ola-mir-92a-23: 15108084-15108186 [+]
Database links

Mature sequence ola-miR-18

Accession MIMAT0022532
Sequence

24 - 

uaaggugcaucuagugcagauag

 - 46

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).