Stem-loop sequence tur-mir-34

AccessionMI0019396 (change log)
DescriptionTetranychus urticae miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   a    -ugc         -     ug     c       -  aa 
5'  uggu    gaugugugg cagug  guuag ugguugu gu  u
    ||||    ||||||||| |||||  ||||| ||||||| ||  a
3'  gccg    cuacauacc gucac  uaguc accaaca ca  u
   a    uagc         c     gu     -       a  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tur-miR-34-5p

Accession MIMAT0023096
Sequence

15 - 

uggcagugugguuagcugguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tur-miR-34-3p

Accession MIMAT0023097
Sequence

54 - 

ccacugauugcacugcccaua

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22113690 "The genome of Tetranychus urticae reveals herbivorous pest adaptations" Grbic M, Van Leeuwen T, Clark RM, Rombauts S, Rouze P, Grbic V, Osborne EJ, Dermauw W, Ngoc PC, Ortego F, Hernandez-Crespo P, Diaz I, Martinez M, Navajas M, Sucena E, Magalhaes S, Nagy L, Pace RM, Djuranovic S, Smagghe G, Iga M, Christiaens O, Veenstra JA Nature. 479:487-492(2011).