Stem-loop sequence tur-mir-9-1

AccessionMI0019388 (change log)
DescriptionTetranychus urticae miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention tur-mir-9-1
(1 sentences)

Stem-loop
   -    auu      uc        uu       c    ---  cc 
5'  gcug   uccuca  uuugguua  uagcuuu ugau   ug  c
    ||||   ||||||  ||||||||  ||||||| ||||   ||   
3'  cgac   aggagu  aaaccaau  aucgaaa acua   ac  g
   u    -cc      uu        uu       u    caa  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tur-miR-9-5p

Accession MIMAT0023082
Sequence

14 - 

ucuuugguuauuuagcuuucuga

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tur-miR-9-3p

Accession MIMAT0023083
Sequence

54 - 

auaaagcuauuuaaccaaauuug

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22113690 "The genome of Tetranychus urticae reveals herbivorous pest adaptations" Grbic M, Van Leeuwen T, Clark RM, Rombauts S, Rouze P, Grbic V, Osborne EJ, Dermauw W, Ngoc PC, Ortego F, Hernandez-Crespo P, Diaz I, Martinez M, Navajas M, Sucena E, Magalhaes S, Nagy L, Pace RM, Djuranovic S, Smagghe G, Iga M, Christiaens O, Veenstra JA Nature. 479:487-492(2011).