Stem-loop sequence tur-mir-184

AccessionMI0019382 (change log)
DescriptionTetranychus urticae miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   a   ug       u auc         u   cg        -a  ga   a 
5'  uua  uguuccu c   uccuuauca uuc  cuguccag  ca  uua u
    |||  ||||||| |   ||||||||| |||  ||||||||  ||  |||  
3'  aau  acaggga g   gggaauagu aag  ggcagguc  gu  aau g
   a   ug       c aac         c   -a        ca  aa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tur-miR-184-5p

Accession MIMAT0023072
Sequence

20 - 

ccuuaucauuuccgcuguccaga

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tur-miR-184-3p

Accession MIMAT0023073
Sequence

64 - 

uggacggagaacugauaagggc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22113690 "The genome of Tetranychus urticae reveals herbivorous pest adaptations" Grbic M, Van Leeuwen T, Clark RM, Rombauts S, Rouze P, Grbic V, Osborne EJ, Dermauw W, Ngoc PC, Ortego F, Hernandez-Crespo P, Diaz I, Martinez M, Navajas M, Sucena E, Magalhaes S, Nagy L, Pace RM, Djuranovic S, Smagghe G, Iga M, Christiaens O, Veenstra JA Nature. 479:487-492(2011).