Stem-loop sequence tur-mir-281

AccessionMI0019368 (change log)
DescriptionTetranychus urticae miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   -     uc    u         uua     a      auuuaa 
5'  gguca  auca gaagagagc   uccgu gacagu      u
    |||||  |||| |||||||||   ||||| ||||||       
3'  ccagu  uggu uuucucucg   aggua cuguca      c
   u     -c    c         uug     -      ccuuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tur-miR-281-5p

Accession MIMAT0023046
Sequence

14 - 

aagagagcuuauccguagacag

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tur-miR-281-3p

Accession MIMAT0023047
Sequence

53 - 

ugucauggaguugcucucuuuc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22113690 "The genome of Tetranychus urticae reveals herbivorous pest adaptations" Grbic M, Van Leeuwen T, Clark RM, Rombauts S, Rouze P, Grbic V, Osborne EJ, Dermauw W, Ngoc PC, Ortego F, Hernandez-Crespo P, Diaz I, Martinez M, Navajas M, Sucena E, Magalhaes S, Nagy L, Pace RM, Djuranovic S, Smagghe G, Iga M, Christiaens O, Veenstra JA Nature. 479:487-492(2011).