Stem-loop sequence ssl-MIR828

AccessionMI0019355 (change log)
DescriptionSalvia sclarea miR828 stem-loop
Gene family MIPF0000544; MIR828
Stem-loop
   ----------------------------ucuugcucaaaugaguauuc  a         -     --      uuu 
5'                                                 ca agagaugca gaaug  cuaugg   g
                                                   || ||||||||| |||||  ||||||   u
3'                                                 gu ucuuugugu cuuau  gaugcc   u
   gaaacggguuuacucguagagucuucgucuacgugaagguuugacuau  g         u     aa      uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssl-miR828

Accession MIMAT0022521
Sequence

1 - 

ucuugcucaaaugaguauucca

 - 22

Get sequence
Evidence experimental; 454 [1]

References

1