Stem-loop sequence ssl-MIR396

AccessionMI0019351 (change log)
DescriptionSalvia sclarea miR396 stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
               c          cg a c    -       gca 
5' uuccacagcuuu uugaacugcg  g a ugua cgucgcc   c
   |||||||||||| ||||||||||  | | |||| |||||||    
3' agggugucgaaa aacuuggcgu  u u acgu guagcgg   c
               u          au c a    a       agg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssl-miR396

Accession MIMAT0022517
Sequence

1 - 

uuccacagcuuucuugaacug

 - 21

Get sequence
Evidence experimental; 454 [1]

References

1