Stem-loop sequence bra-MIR5726

AccessionMI0019339 (change log)
DescriptionBrassica rapa miR5726 stem-loop
Literature search

2 open access papers mention bra-MIR5726
(2 sentences)

Stem-loop
   a    aagga  c                                         u                                                                   auu  acuc    aacuucuacucucuaaaacucucucuucucucuaugc 
5'  gaug     ca guaguaaaucaaaugccggcaccacuagaagacgacacguu aaagaccuuauucaagcaaccuuugccuauaaauauguauucaugaucaaggaagggggcacgagcg   uc    ucua                                     g
    ||||     || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||    ||||                                      
3'  cuac     gu uauuauuuaguuuacggccguggugaucuucugcugugcaa uuucuggaauaaguucguuggaaacggauauuuaugcguaaguacuaguuccuucccccgugcucgu   ag    agau                                     a
   -    gagaa  u                                         c                                                                   ---  gaaa    cuaacgaacuuauuccucucguaggaauaguauuggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 19127792-19128133 [-]
intergenic
Database links

Mature sequence bra-miR5726

Accession MIMAT0023025
Sequence

264 - 

caaagguugcuugaauaaggu

 - 284

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).