Stem-loop sequence bra-MIR5725

AccessionMI0019338 (change log)
DescriptionBrassica rapa miR5725 stem-loop
Literature search

1 open access papers mention bra-MIR5725
(1 sentences)

Stem-loop
   --------------       cu   uuacgu                                                       a            c   -    aau 
5'               aagguau  ucu      uaacaaauaguauacgaugcagaucagauugugccaaaucuaaaaauuacuuaag acacacauaugu aau ucau   c
                 |||||||  |||      ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||    
3'               uucuaua  agg      auuguuuaucauaugcuacgucuagucuaacacgguuuagauuuuuaaugaauuc uguguguauaca uua ggua   a
   aaggauuaaaagga       uu   ------                                                       g            a   u    ccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA8: 5349176-5349380 [+]
intergenic
Database links

Mature sequence bra-miR5725

Accession MIMAT0023024
Sequence

141 - 

auuuggcacaaucugaucugc

 - 161

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).