Stem-loop sequence bra-MIR5724

AccessionMI0019337 (change log)
DescriptionBrassica rapa miR5724 stem-loop
Literature search

4 open access papers mention bra-MIR5724
(4 sentences)

Stem-loop
   -    uu       --------    cu c    gug           u      gaugcauug     ---                -ua   a   ag             g        c    g          augaacauauccaugcaucaccauaaacg 
5'  caga  gucuaca        gaug  a aaca   aggaguuuggu ggagau         acguu   guugauagugcaaaaa   uag gac  uaaccgccgguuu auaauagc uuua ggugaauugg                             g
    ||||  |||||||        ||||  | ||||   ||||||||||| ||||||         |||||   ||||||||||||||||   ||| |||  ||||||||||||| |||||||| |||| ||||||||||                              
3'  gucu  cgggugu        cuac  u uugu   uccucaagcca ccuuua         ugcaa   caacuaucacguuuuu   auc cug  auuggcggccaaa uauuaucg aaau ccgcuuaacc                             u
   a    --       acuauaaa    uu a    --a           u      ---------     ccg                uac   g   ag             a        a    g          cucgaacgagaacaccaagaacgacagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA8: 13793832-13794141 [+]
intergenic
Database links

Mature sequence bra-miR5724

Accession MIMAT0023023
Sequence

89 - 

aaccgccgguuugauaauagc

 - 109

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).