Stem-loop sequence bra-MIR5723

AccessionMI0019336 (change log)
DescriptionBrassica rapa miR5723 stem-loop
Literature search

1 open access papers mention bra-MIR5723
(1 sentences)

Stem-loop
   ---        c                                    aacauuguuuuuuuucauuugcuuuugugcugua 
5'    gcuaugga uuccaccuucgugaaaugugcugcaauaucucugca                                  u
      |||||||| ||||||||||||||||||||||||||||||||||||                                   
3'    cgauaccu aagguggaagcacuuuacacgacguuauagagacgu                                  c
   aca        u                                    cuuuugauuagaucaaauaucgguagauaguuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA2: 22331161-22331323 [-]
intergenic
Database links

Mature sequence bra-miR5723

Accession MIMAT0023022
Sequence

24 - 

aaugugcugcaauaucucugc

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).