Stem-loop sequence bra-MIR1140

AccessionMI0019335 (change log)
DescriptionBrassica rapa miR1140 stem-loop
Gene family MIPF0001568; MIR1140
Literature search

1 open access papers mention bra-MIR1140
(2 sentences)

Stem-loop
   uc    ---guucu    a  uuuua               c                 u      cuuucuaaagucuucaaaauuuagu 
5'   cccu        cuca uc     uauggcuccgauugg uuuaggcuguuguggcu ugacuu                         u
     ||||        |||| ||     ||||||||||||||| ||||||||||||||||| ||||||                         u
3'   ggga        gagu ag     guaccgaggcuaacc aaauccgacaacaccga acugaa                         u
   --    auguucuu    -  ---ug               -                 c      aauuuuuuuaaauugcacuaacacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 683631-683805 [+]
intergenic
Database links

Mature sequence bra-miR1140

Accession MIMAT0023021
Sequence

131 - 

acagccuaaaccaaucggagc

 - 151

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).
2