Stem-loop sequence bra-MIR5720

AccessionMI0019332 (change log)
DescriptionBrassica rapa miR5720 stem-loop
Literature search

1 open access papers mention bra-MIR5720
(1 sentences)

Stem-loop
   -------                                  u                 cg           uua                                              -----           c   u   aa  cug 
5'        aaacuuguaaaagaaaaucaucguacaguuaaaa uucuacgauaauucauu  aaguuuugcaa   auguuauacagauauucuaaccaaaucacaaaaccauaauacugua     uaccuauauau ucg cua  ag   c
          |||||||||||||||||||||||||||||||||| |||||||||||||||||  |||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||     ||||||||||| ||| |||  ||    
3'        uuugagcauuuucuuuuaguagcaugucaauuuu aaggugcuauuaaguaa  uucaaaacguu   uacaauaugucuauaagguugguuuaguguuuugguauuaugacau     auggauauaua agu gau  uc   a
   uucuucu                                  u                 au           ---                                              aucau           a   -   ga  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA9: 640193-640482 [+]
intergenic
Database links

Mature sequence bra-miR5720

Accession MIMAT0023018
Sequence

188 - 

uugugauuugguuggaauauc

 - 208

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).