Stem-loop sequence bra-MIR5719

AccessionMI0019331 (change log)
DescriptionBrassica rapa miR5719 stem-loop
Literature search

2 open access papers mention bra-MIR5719
(2 sentences)

Stem-loop
   u      u   -    -c    --       a     a                a         a   cc   c      a    uaaucgacaucaucaagc 
5'  gaucuc cuu gcuu  uaaa  uuuuuuu gaucu guguugugaugauaau cgacuucca gau  aaa caacaa uuuc                  a
    |||||| ||| ||||  ||||  ||||||| ||||| |||||||||||||||| ||||||||| |||  ||| |||||| ||||                  u
3'  cuaggg gaa cgaa  auuu  aaaaaaa cuaga cacaacacuacuauua gcugaaggu cug  uuu guuguu aaag                  g
   a      u   a    aa    uc       a     a                g         a   -a   a      c    uuguaccagugguacuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 30606326-30606529 [-]
intergenic
Database links

Mature sequence bra-miR5719

Accession MIMAT0023017
Sequence

38 - 

uugugaugauaauacgacuuc

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).